论文部分内容阅读
Water buffaloes are widespread throughout central and southern China, and it is the third largest population of buffalo in the world with the total number of almost 23 million in 2003.The mtDNA have been widely used for studying of the mammalian evolution and genetics as well as the documentation of the phylogenetic position.The objectives of this study are to investigate molecular genetic characteristics of Dongliu Buffalo based on the sequence of mtDNA D-Loop and Cytb gene, and to provide scientific basis for further study of Chinese Buffalo.A total of 31 fresh blood samples in unrelated individuals were collected from Dongzhi County in Anhui province and DNA was isolated using a standard extraction method of phenol/chloroform.915bp mtDNA Control region sequences of Dongliu buffalo were amplified with primers CB1:TAGTGCTAATACCAACGGCC and CB2: AGGCATTTTCAGTGCCTTGC and Cytb sequence was amplified with primers CB3: ACCACGACCAATGATATGAAAAACC and CB4: GAGGTTGGTTGTTCTCCTYTTCTGG.The PCR reaction was performed in a volume of 20 μL containing 20 ng DNA template, 2 μL 10x PCR buffer,1.6 μL 2.5 mM dNTP mix, 0.5 μL each of primer (100 ng/μL), 0.2 μL 5 U r-Taq DNA polymerase (Fermentas,Vilnius, Lithuania) and sterile water.The PCR reaction conditions were 5 min at 95℃, followed by 32 cycles at95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, and followed by a final extension of 72℃ for 5 min.The PCR products were purified and sequenced.The sequences of 31 buffaloes were analyzed together with the published D-loop sequences of 23 Dongliu buffaloes in GenBank, 73 nucleotide polymorphic sites and35 haplotypes were identified in the population, the nucleotide diversity and haplotype diversity were(0.01331±0.00208) and (0.944±0.023), respectively.17 nucleotide polymorphisms and 7 haplotypes were detected in Cytb gene of 31 Dongliu buffaloes, and the nucleotide diversity and haplotype diversity were(0.00112±0.00091) and (0.544±0.107), respectively.The Neighbor-Joining tree of mtDNA D-loop and Cytb gene indicated that the mtDNA were divided into two lineages, the A and B lines of swamp buffaloes.Moreover, the17 nucleotide polymorphisms in Cytb gene generated 7 missense mutation, the sites were 6(Lys→Glu),17(Ala→Thr), 171(Asn→Tyr), 199(Phe→Tyr), 238(Ala→Thr), 358(Tyr→His) and 372(Ile→Val).There were two stop codons of AGA and AGG detected in Cytb gene in Dongliu buffaloes.With the study of genetic variation and phylogeney of Mitochondrial DNA D-Loop and Cytb gene, we found that Dongliu Buffalo exhibits similar genetic diversity with Chinese swamp buffaloes.There is rich mitochondrial genetic diversity in Dongliu buffalo population, and they originate from two maternal swamp buffalo.